Fluorescence-detected interactions of oligonucleotides in RecA complexes
Journal article, 1995

A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.

mechanism

solution

fluorescence

recombination

linear dichroism

escherichia-coli

renaturation

protein

genetic-recombination

stoichiometry

coordination

reca

spectroscopy

benzo(a)pyrenediolepoxide

conformation

dna complexes

Author

Pernilla Wittung

Department of Physical Chemistry

M. Funk

B. Jernstrom

Bengt Nordén

Department of Physical Chemistry

M. Takahashi

FEBS Letters

0014-5793 (ISSN)

Vol. 368 1 64-68

Subject Categories

Biochemistry and Molecular Biology

DOI

10.1016/0014-5793(95)00600-E

More information

Latest update

10/15/2018